cDNA Synthesis:Article Title: In Vivo Labeling by CD73 Marks Multipotent Stromal Cells and Highlights Endothelial Heterogeneity in the Bone Marrow Niche.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Ascorbic acid Sigma Cat# A4544 b-Glycerol phosphate disodium salt Calbiochem Cat# 35675 Alizarin Red S Sigma Cat# A5533 3-Isobutyl-1-methylxanthine Sigma Cat# I5879 Hydrocortisone Sigma Cat# H0888 Indomethacin Sigma Cat# I7378 Insulin Sigma Cat# I9278 Oil red O Sigma Cat# O0625 L-proline Sigma Cat# P5607 Sodium pyruvate GIBCO Cat# 11360 ITS liquid Media Supplement Sigma Cat# I3146 Alcian Blue Sigma Cat# A3157 Endothelial cell proliferation medium Provitro Cat# 201 0001 MesenCult medium Stemcell Technology Cat# 05513 BD Matrigel Matrix BD Biosciences Cat# 354234 bisBenzimide H 33342 trihydrochloride Sigma Cat# 14533 Platinum Taq Polymerase Invitrogen Cat# 10966-018 SUPERase-In RNase Inhibitor Ambion Cat# AM2694 Critical Commercial Assays PE Annexin V Apoptosis Detection Kit I BD Biosciences Cat# 559763 SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat# 11754250 CellDirect One-Step qRT-PCR Kits Invitrogen Cat# 11753-100 SMARTer Ultra Low Input RNA Kit Clontech Cat# 634848 Agilent High Sensitivity DNA Kit Agilent Cat# 5067-4626 Nextera DNA Library Preparation Kit Illumina Cat# FC-121-1030 Deposited Data RNA-Seq DATA This paper Raw sequencing data were deposited in the European Nucleotide Archive (ENA) under the accession ENA: PRJEB23422 (ERP105176) Experimental Models: Cell Lines Mouse: G4 ES cells George et al., 2007 provided by A. Nagy and M. Gertsenstein (Toronto, Canada) Experimental Models: Organisms/Strains Mouse: C57BL/6J The Jackson Laboratory JAX: 006494 Mouse: CD1 Charles River Laboratories CRL:22 Oligonucleotides Please see Table S1 This paper NA Primer: EGFP Forward: ACTCCGCAGTTTAGTA GAGG, Reverse: GTCTTGTAGTTGCCGTCGTC This paper NA Recombinant DNA pEGFP1 Clontech Cat# 6086-1 BAC clone RP24-316M18 CHORI, bacpac.chori.org https://bacpacresources.org Software and Algorithms FlowJo Tree Star https://www.flowjo.com NIS-Elements Confocal Nikon https://www.nikoninstruments.com Biomark system Fluidigm https://www.fluidigm.com/ GraphPad Prism GraphPad https://www.graphpad.com/scientific- software/prism/ R R developer team https://cran.r-project.org/ (Continued on next page) e2 Cell Stem Cell 22, 262–276.e1–e7, February 1, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Rstudio Rstudio https://www.rstudio.com/ Bioconductor - R-based computing platform Bioconductor developer team https://bioconductor.org/ Rsubread - Bioconductor package Liao et al., 2013 https://bioconductor.org/packages/release/ bioc/html/Rsubread.html edgeR - Bioconductor package Robinson et al., 2010 https://bioconductor.org/packages/release/ bioc/html/edgeR.html Voom - algorithm (implemented in limma) Law et al., 2014 http://genomebiology.biomedcentral.com/ articles/10.1186/gb-2014-15-2-r29 https://bioconductor.org/packages/release/ bioc/html/limma.html
Quantitative RT-PCR:Article Title: In Vivo Labeling by CD73 Marks Multipotent Stromal Cells and Highlights Endothelial Heterogeneity in the Bone Marrow Niche.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Ascorbic acid Sigma Cat# A4544 b-Glycerol phosphate disodium salt Calbiochem Cat# 35675 Alizarin Red S Sigma Cat# A5533 3-Isobutyl-1-methylxanthine Sigma Cat# I5879 Hydrocortisone Sigma Cat# H0888 Indomethacin Sigma Cat# I7378 Insulin Sigma Cat# I9278 Oil red O Sigma Cat# O0625 L-proline Sigma Cat# P5607 Sodium pyruvate GIBCO Cat# 11360 ITS liquid Media Supplement Sigma Cat# I3146 Alcian Blue Sigma Cat# A3157 Endothelial cell proliferation medium Provitro Cat# 201 0001 MesenCult medium Stemcell Technology Cat# 05513 BD Matrigel Matrix BD Biosciences Cat# 354234 bisBenzimide H 33342 trihydrochloride Sigma Cat# 14533 Platinum Taq Polymerase Invitrogen Cat# 10966-018 SUPERase-In RNase Inhibitor Ambion Cat# AM2694 Critical Commercial Assays PE Annexin V Apoptosis Detection Kit I BD Biosciences Cat# 559763 SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat# 11754250 CellDirect One-Step qRT-PCR Kits Invitrogen Cat# 11753-100 SMARTer Ultra Low Input RNA Kit Clontech Cat# 634848 Agilent High Sensitivity DNA Kit Agilent Cat# 5067-4626 Nextera DNA Library Preparation Kit Illumina Cat# FC-121-1030 Deposited Data RNA-Seq DATA This paper Raw sequencing data were deposited in the European Nucleotide Archive (ENA) under the accession ENA: PRJEB23422 (ERP105176) Experimental Models: Cell Lines Mouse: G4 ES cells George et al., 2007 provided by A. Nagy and M. Gertsenstein (Toronto, Canada) Experimental Models: Organisms/Strains Mouse: C57BL/6J The Jackson Laboratory JAX: 006494 Mouse: CD1 Charles River Laboratories CRL:22 Oligonucleotides Please see Table S1 This paper NA Primer: EGFP Forward: ACTCCGCAGTTTAGTA GAGG, Reverse: GTCTTGTAGTTGCCGTCGTC This paper NA Recombinant DNA pEGFP1 Clontech Cat# 6086-1 BAC clone RP24-316M18 CHORI, bacpac.chori.org https://bacpacresources.org Software and Algorithms FlowJo Tree Star https://www.flowjo.com NIS-Elements Confocal Nikon https://www.nikoninstruments.com Biomark system Fluidigm https://www.fluidigm.com/ GraphPad Prism GraphPad https://www.graphpad.com/scientific- software/prism/ R R developer team https://cran.r-project.org/ (Continued on next page) e2 Cell Stem Cell 22, 262–276.e1–e7, February 1, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Rstudio Rstudio https://www.rstudio.com/ Bioconductor - R-based computing platform Bioconductor developer team https://bioconductor.org/ Rsubread - Bioconductor package Liao et al., 2013 https://bioconductor.org/packages/release/ bioc/html/Rsubread.html edgeR - Bioconductor package Robinson et al., 2010 https://bioconductor.org/packages/release/ bioc/html/edgeR.html Voom - algorithm (implemented in limma) Law et al., 2014 http://genomebiology.biomedcentral.com/ articles/10.1186/gb-2014-15-2-r29 https://bioconductor.org/packages/release/ bioc/html/limma.html
DNA Library Preparation:Article Title: In Vivo Labeling by CD73 Marks Multipotent Stromal Cells and Highlights Endothelial Heterogeneity in the Bone Marrow Niche.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Ascorbic acid Sigma Cat# A4544 b-Glycerol phosphate disodium salt Calbiochem Cat# 35675 Alizarin Red S Sigma Cat# A5533 3-Isobutyl-1-methylxanthine Sigma Cat# I5879 Hydrocortisone Sigma Cat# H0888 Indomethacin Sigma Cat# I7378 Insulin Sigma Cat# I9278 Oil red O Sigma Cat# O0625 L-proline Sigma Cat# P5607 Sodium pyruvate GIBCO Cat# 11360 ITS liquid Media Supplement Sigma Cat# I3146 Alcian Blue Sigma Cat# A3157 Endothelial cell proliferation medium Provitro Cat# 201 0001 MesenCult medium Stemcell Technology Cat# 05513 BD Matrigel Matrix BD Biosciences Cat# 354234 bisBenzimide H 33342 trihydrochloride Sigma Cat# 14533 Platinum Taq Polymerase Invitrogen Cat# 10966-018 SUPERase-In RNase Inhibitor Ambion Cat# AM2694 Critical Commercial Assays PE Annexin V Apoptosis Detection Kit I BD Biosciences Cat# 559763 SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat# 11754250 CellDirect One-Step qRT-PCR Kits Invitrogen Cat# 11753-100 SMARTer Ultra Low Input RNA Kit Clontech Cat# 634848 Agilent High Sensitivity DNA Kit Agilent Cat# 5067-4626 Nextera DNA Library Preparation Kit Illumina Cat# FC-121-1030 Deposited Data RNA-Seq DATA This paper Raw sequencing data were deposited in the European Nucleotide Archive (ENA) under the accession ENA: PRJEB23422 (ERP105176) Experimental Models: Cell Lines Mouse: G4 ES cells George et al., 2007 provided by A. Nagy and M. Gertsenstein (Toronto, Canada) Experimental Models: Organisms/Strains Mouse: C57BL/6J The Jackson Laboratory JAX: 006494 Mouse: CD1 Charles River Laboratories CRL:22 Oligonucleotides Please see Table S1 This paper NA Primer: EGFP Forward: ACTCCGCAGTTTAGTA GAGG, Reverse: GTCTTGTAGTTGCCGTCGTC This paper NA Recombinant DNA pEGFP1 Clontech Cat# 6086-1 BAC clone RP24-316M18 CHORI, bacpac.chori.org https://bacpacresources.org Software and Algorithms FlowJo Tree Star https://www.flowjo.com NIS-Elements Confocal Nikon https://www.nikoninstruments.com Biomark system Fluidigm https://www.fluidigm.com/ GraphPad Prism GraphPad https://www.graphpad.com/scientific- software/prism/ R R developer team https://cran.r-project.org/ (Continued on next page) e2 Cell Stem Cell 22, 262–276.e1–e7, February 1, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Rstudio Rstudio https://www.rstudio.com/ Bioconductor - R-based computing platform Bioconductor developer team https://bioconductor.org/ Rsubread - Bioconductor package Liao et al., 2013 https://bioconductor.org/packages/release/ bioc/html/Rsubread.html edgeR - Bioconductor package Robinson et al., 2010 https://bioconductor.org/packages/release/ bioc/html/edgeR.html Voom - algorithm (implemented in limma) Law et al., 2014 http://genomebiology.biomedcentral.com/ articles/10.1186/gb-2014-15-2-r29 https://bioconductor.org/packages/release/ bioc/html/limma.html
RNA sequencing:Article Title: In Vivo Labeling by CD73 Marks Multipotent Stromal Cells and Highlights Endothelial Heterogeneity in the Bone Marrow Niche.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Ascorbic acid Sigma Cat# A4544 b-Glycerol phosphate disodium salt Calbiochem Cat# 35675 Alizarin Red S Sigma Cat# A5533 3-Isobutyl-1-methylxanthine Sigma Cat# I5879 Hydrocortisone Sigma Cat# H0888 Indomethacin Sigma Cat# I7378 Insulin Sigma Cat# I9278 Oil red O Sigma Cat# O0625 L-proline Sigma Cat# P5607 Sodium pyruvate GIBCO Cat# 11360 ITS liquid Media Supplement Sigma Cat# I3146 Alcian Blue Sigma Cat# A3157 Endothelial cell proliferation medium Provitro Cat# 201 0001 MesenCult medium Stemcell Technology Cat# 05513 BD Matrigel Matrix BD Biosciences Cat# 354234 bisBenzimide H 33342 trihydrochloride Sigma Cat# 14533 Platinum Taq Polymerase Invitrogen Cat# 10966-018 SUPERase-In RNase Inhibitor Ambion Cat# AM2694 Critical Commercial Assays PE Annexin V Apoptosis Detection Kit I BD Biosciences Cat# 559763 SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat# 11754250 CellDirect One-Step qRT-PCR Kits Invitrogen Cat# 11753-100 SMARTer Ultra Low Input RNA Kit Clontech Cat# 634848 Agilent High Sensitivity DNA Kit Agilent Cat# 5067-4626 Nextera DNA Library Preparation Kit Illumina Cat# FC-121-1030 Deposited Data RNA-Seq DATA This paper Raw sequencing data were deposited in the European Nucleotide Archive (ENA) under the accession ENA: PRJEB23422 (ERP105176) Experimental Models: Cell Lines Mouse: G4 ES cells George et al., 2007 provided by A. Nagy and M. Gertsenstein (Toronto, Canada) Experimental Models: Organisms/Strains Mouse: C57BL/6J The Jackson Laboratory JAX: 006494 Mouse: CD1 Charles River Laboratories CRL:22 Oligonucleotides Please see Table S1 This paper NA Primer: EGFP Forward: ACTCCGCAGTTTAGTA GAGG, Reverse: GTCTTGTAGTTGCCGTCGTC This paper NA Recombinant DNA pEGFP1 Clontech Cat# 6086-1 BAC clone RP24-316M18 CHORI, bacpac.chori.org https://bacpacresources.org Software and Algorithms FlowJo Tree Star https://www.flowjo.com NIS-Elements Confocal Nikon https://www.nikoninstruments.com Biomark system Fluidigm https://www.fluidigm.com/ GraphPad Prism GraphPad https://www.graphpad.com/scientific- software/prism/ R R developer team https://cran.r-project.org/ (Continued on next page) e2 Cell Stem Cell 22, 262–276.e1–e7, February 1, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Rstudio Rstudio https://www.rstudio.com/ Bioconductor - R-based computing platform Bioconductor developer team https://bioconductor.org/ Rsubread - Bioconductor package Liao et al., 2013 https://bioconductor.org/packages/release/ bioc/html/Rsubread.html edgeR - Bioconductor package Robinson et al., 2010 https://bioconductor.org/packages/release/ bioc/html/edgeR.html Voom - algorithm (implemented in limma) Law et al., 2014 http://genomebiology.biomedcentral.com/ articles/10.1186/gb-2014-15-2-r29 https://bioconductor.org/packages/release/ bioc/html/limma.html
Sequencing:Article Title: In Vivo Labeling by CD73 Marks Multipotent Stromal Cells and Highlights Endothelial Heterogeneity in the Bone Marrow Niche.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Ascorbic acid Sigma Cat# A4544 b-Glycerol phosphate disodium salt Calbiochem Cat# 35675 Alizarin Red S Sigma Cat# A5533 3-Isobutyl-1-methylxanthine Sigma Cat# I5879 Hydrocortisone Sigma Cat# H0888 Indomethacin Sigma Cat# I7378 Insulin Sigma Cat# I9278 Oil red O Sigma Cat# O0625 L-proline Sigma Cat# P5607 Sodium pyruvate GIBCO Cat# 11360 ITS liquid Media Supplement Sigma Cat# I3146 Alcian Blue Sigma Cat# A3157 Endothelial cell proliferation medium Provitro Cat# 201 0001 MesenCult medium Stemcell Technology Cat# 05513 BD Matrigel Matrix BD Biosciences Cat# 354234 bisBenzimide H 33342 trihydrochloride Sigma Cat# 14533 Platinum Taq Polymerase Invitrogen Cat# 10966-018 SUPERase-In RNase Inhibitor Ambion Cat# AM2694 Critical Commercial Assays PE Annexin V Apoptosis Detection Kit I BD Biosciences Cat# 559763 SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat# 11754250 CellDirect One-Step qRT-PCR Kits Invitrogen Cat# 11753-100 SMARTer Ultra Low Input RNA Kit Clontech Cat# 634848 Agilent High Sensitivity DNA Kit Agilent Cat# 5067-4626 Nextera DNA Library Preparation Kit Illumina Cat# FC-121-1030 Deposited Data RNA-Seq DATA This paper Raw sequencing data were deposited in the European Nucleotide Archive (ENA) under the accession ENA: PRJEB23422 (ERP105176) Experimental Models: Cell Lines Mouse: G4 ES cells George et al., 2007 provided by A. Nagy and M. Gertsenstein (Toronto, Canada) Experimental Models: Organisms/Strains Mouse: C57BL/6J The Jackson Laboratory JAX: 006494 Mouse: CD1 Charles River Laboratories CRL:22 Oligonucleotides Please see Table S1 This paper NA Primer: EGFP Forward: ACTCCGCAGTTTAGTA GAGG, Reverse: GTCTTGTAGTTGCCGTCGTC This paper NA Recombinant DNA pEGFP1 Clontech Cat# 6086-1 BAC clone RP24-316M18 CHORI, bacpac.chori.org https://bacpacresources.org Software and Algorithms FlowJo Tree Star https://www.flowjo.com NIS-Elements Confocal Nikon https://www.nikoninstruments.com Biomark system Fluidigm https://www.fluidigm.com/ GraphPad Prism GraphPad https://www.graphpad.com/scientific- software/prism/ R R developer team https://cran.r-project.org/ (Continued on next page) e2 Cell Stem Cell 22, 262–276.e1–e7, February 1, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Rstudio Rstudio https://www.rstudio.com/ Bioconductor - R-based computing platform Bioconductor developer team https://bioconductor.org/ Rsubread - Bioconductor package Liao et al., 2013 https://bioconductor.org/packages/release/ bioc/html/Rsubread.html edgeR - Bioconductor package Robinson et al., 2010 https://bioconductor.org/packages/release/ bioc/html/edgeR.html Voom - algorithm (implemented in limma) Law et al., 2014 http://genomebiology.biomedcentral.com/ articles/10.1186/gb-2014-15-2-r29 https://bioconductor.org/packages/release/ bioc/html/limma.html
Recombinant:Article Title: In Vivo Labeling by CD73 Marks Multipotent Stromal Cells and Highlights Endothelial Heterogeneity in the Bone Marrow Niche.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Ascorbic acid Sigma Cat# A4544 b-Glycerol phosphate disodium salt Calbiochem Cat# 35675 Alizarin Red S Sigma Cat# A5533 3-Isobutyl-1-methylxanthine Sigma Cat# I5879 Hydrocortisone Sigma Cat# H0888 Indomethacin Sigma Cat# I7378 Insulin Sigma Cat# I9278 Oil red O Sigma Cat# O0625 L-proline Sigma Cat# P5607 Sodium pyruvate GIBCO Cat# 11360 ITS liquid Media Supplement Sigma Cat# I3146 Alcian Blue Sigma Cat# A3157 Endothelial cell proliferation medium Provitro Cat# 201 0001 MesenCult medium Stemcell Technology Cat# 05513 BD Matrigel Matrix BD Biosciences Cat# 354234 bisBenzimide H 33342 trihydrochloride Sigma Cat# 14533 Platinum Taq Polymerase Invitrogen Cat# 10966-018 SUPERase-In RNase Inhibitor Ambion Cat# AM2694 Critical Commercial Assays PE Annexin V Apoptosis Detection Kit I BD Biosciences Cat# 559763 SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat# 11754250 CellDirect One-Step qRT-PCR Kits Invitrogen Cat# 11753-100 SMARTer Ultra Low Input RNA Kit Clontech Cat# 634848 Agilent High Sensitivity DNA Kit Agilent Cat# 5067-4626 Nextera DNA Library Preparation Kit Illumina Cat# FC-121-1030 Deposited Data RNA-Seq DATA This paper Raw sequencing data were deposited in the European Nucleotide Archive (ENA) under the accession ENA: PRJEB23422 (ERP105176) Experimental Models: Cell Lines Mouse: G4 ES cells George et al., 2007 provided by A. Nagy and M. Gertsenstein (Toronto, Canada) Experimental Models: Organisms/Strains Mouse: C57BL/6J The Jackson Laboratory JAX: 006494 Mouse: CD1 Charles River Laboratories CRL:22 Oligonucleotides Please see Table S1 This paper NA Primer: EGFP Forward: ACTCCGCAGTTTAGTA GAGG, Reverse: GTCTTGTAGTTGCCGTCGTC This paper NA Recombinant DNA pEGFP1 Clontech Cat# 6086-1 BAC clone RP24-316M18 CHORI, bacpac.chori.org https://bacpacresources.org Software and Algorithms FlowJo Tree Star https://www.flowjo.com NIS-Elements Confocal Nikon https://www.nikoninstruments.com Biomark system Fluidigm https://www.fluidigm.com/ GraphPad Prism GraphPad https://www.graphpad.com/scientific- software/prism/ R R developer team https://cran.r-project.org/ (Continued on next page) e2 Cell Stem Cell 22, 262–276.e1–e7, February 1, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Rstudio Rstudio https://www.rstudio.com/ Bioconductor - R-based computing platform Bioconductor developer team https://bioconductor.org/ Rsubread - Bioconductor package Liao et al., 2013 https://bioconductor.org/packages/release/ bioc/html/Rsubread.html edgeR - Bioconductor package Robinson et al., 2010 https://bioconductor.org/packages/release/ bioc/html/edgeR.html Voom - algorithm (implemented in limma) Law et al., 2014 http://genomebiology.biomedcentral.com/ articles/10.1186/gb-2014-15-2-r29 https://bioconductor.org/packages/release/ bioc/html/limma.html
BAC Assay:Article Title: In Vivo Labeling by CD73 Marks Multipotent Stromal Cells and Highlights Endothelial Heterogeneity in the Bone Marrow Niche.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Ascorbic acid Sigma Cat# A4544 b-Glycerol phosphate disodium salt Calbiochem Cat# 35675 Alizarin Red S Sigma Cat# A5533 3-Isobutyl-1-methylxanthine Sigma Cat# I5879 Hydrocortisone Sigma Cat# H0888 Indomethacin Sigma Cat# I7378 Insulin Sigma Cat# I9278 Oil red O Sigma Cat# O0625 L-proline Sigma Cat# P5607 Sodium pyruvate GIBCO Cat# 11360 ITS liquid Media Supplement Sigma Cat# I3146 Alcian Blue Sigma Cat# A3157 Endothelial cell proliferation medium Provitro Cat# 201 0001 MesenCult medium Stemcell Technology Cat# 05513 BD Matrigel Matrix BD Biosciences Cat# 354234 bisBenzimide H 33342 trihydrochloride Sigma Cat# 14533 Platinum Taq Polymerase Invitrogen Cat# 10966-018 SUPERase-In RNase Inhibitor Ambion Cat# AM2694 Critical Commercial Assays PE Annexin V Apoptosis Detection Kit I BD Biosciences Cat# 559763 SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat# 11754250 CellDirect One-Step qRT-PCR Kits Invitrogen Cat# 11753-100 SMARTer Ultra Low Input RNA Kit Clontech Cat# 634848 Agilent High Sensitivity DNA Kit Agilent Cat# 5067-4626 Nextera DNA Library Preparation Kit Illumina Cat# FC-121-1030 Deposited Data RNA-Seq DATA This paper Raw sequencing data were deposited in the European Nucleotide Archive (ENA) under the accession ENA: PRJEB23422 (ERP105176) Experimental Models: Cell Lines Mouse: G4 ES cells George et al., 2007 provided by A. Nagy and M. Gertsenstein (Toronto, Canada) Experimental Models: Organisms/Strains Mouse: C57BL/6J The Jackson Laboratory JAX: 006494 Mouse: CD1 Charles River Laboratories CRL:22 Oligonucleotides Please see Table S1 This paper NA Primer: EGFP Forward: ACTCCGCAGTTTAGTA GAGG, Reverse: GTCTTGTAGTTGCCGTCGTC This paper NA Recombinant DNA pEGFP1 Clontech Cat# 6086-1 BAC clone RP24-316M18 CHORI, bacpac.chori.org https://bacpacresources.org Software and Algorithms FlowJo Tree Star https://www.flowjo.com NIS-Elements Confocal Nikon https://www.nikoninstruments.com Biomark system Fluidigm https://www.fluidigm.com/ GraphPad Prism GraphPad https://www.graphpad.com/scientific- software/prism/ R R developer team https://cran.r-project.org/ (Continued on next page) e2 Cell Stem Cell 22, 262–276.e1–e7, February 1, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Rstudio Rstudio https://www.rstudio.com/ Bioconductor - R-based computing platform Bioconductor developer team https://bioconductor.org/ Rsubread - Bioconductor package Liao et al., 2013 https://bioconductor.org/packages/release/ bioc/html/Rsubread.html edgeR - Bioconductor package Robinson et al., 2010 https://bioconductor.org/packages/release/ bioc/html/edgeR.html Voom - algorithm (implemented in limma) Law et al., 2014 http://genomebiology.biomedcentral.com/ articles/10.1186/gb-2014-15-2-r29 https://bioconductor.org/packages/release/ bioc/html/limma.html
Software:Article Title: In Vivo Labeling by CD73 Marks Multipotent Stromal Cells and Highlights Endothelial Heterogeneity in the Bone Marrow Niche.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Ascorbic acid Sigma Cat# A4544 b-Glycerol phosphate disodium salt Calbiochem Cat# 35675 Alizarin Red S Sigma Cat# A5533 3-Isobutyl-1-methylxanthine Sigma Cat# I5879 Hydrocortisone Sigma Cat# H0888 Indomethacin Sigma Cat# I7378 Insulin Sigma Cat# I9278 Oil red O Sigma Cat# O0625 L-proline Sigma Cat# P5607 Sodium pyruvate GIBCO Cat# 11360 ITS liquid Media Supplement Sigma Cat# I3146 Alcian Blue Sigma Cat# A3157 Endothelial cell proliferation medium Provitro Cat# 201 0001 MesenCult medium Stemcell Technology Cat# 05513 BD Matrigel Matrix BD Biosciences Cat# 354234 bisBenzimide H 33342 trihydrochloride Sigma Cat# 14533 Platinum Taq Polymerase Invitrogen Cat# 10966-018 SUPERase-In RNase Inhibitor Ambion Cat# AM2694 Critical Commercial Assays PE Annexin V Apoptosis Detection Kit I BD Biosciences Cat# 559763 SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat# 11754250 CellDirect One-Step qRT-PCR Kits Invitrogen Cat# 11753-100 SMARTer Ultra Low Input RNA Kit Clontech Cat# 634848 Agilent High Sensitivity DNA Kit Agilent Cat# 5067-4626 Nextera DNA Library Preparation Kit Illumina Cat# FC-121-1030 Deposited Data RNA-Seq DATA This paper Raw sequencing data were deposited in the European Nucleotide Archive (ENA) under the accession ENA: PRJEB23422 (ERP105176) Experimental Models: Cell Lines Mouse: G4 ES cells George et al., 2007 provided by A. Nagy and M. Gertsenstein (Toronto, Canada) Experimental Models: Organisms/Strains Mouse: C57BL/6J The Jackson Laboratory JAX: 006494 Mouse: CD1 Charles River Laboratories CRL:22 Oligonucleotides Please see Table S1 This paper NA Primer: EGFP Forward: ACTCCGCAGTTTAGTA GAGG, Reverse: GTCTTGTAGTTGCCGTCGTC This paper NA Recombinant DNA pEGFP1 Clontech Cat# 6086-1 BAC clone RP24-316M18 CHORI, bacpac.chori.org https://bacpacresources.org Software and Algorithms FlowJo Tree Star https://www.flowjo.com NIS-Elements Confocal Nikon https://www.nikoninstruments.com Biomark system Fluidigm https://www.fluidigm.com/ GraphPad Prism GraphPad https://www.graphpad.com/scientific- software/prism/ R R developer team https://cran.r-project.org/ (Continued on next page) e2 Cell Stem Cell 22, 262–276.e1–e7, February 1, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Rstudio Rstudio https://www.rstudio.com/ Bioconductor - R-based computing platform Bioconductor developer team https://bioconductor.org/ Rsubread - Bioconductor package Liao et al., 2013 https://bioconductor.org/packages/release/ bioc/html/Rsubread.html edgeR - Bioconductor package Robinson et al., 2010 https://bioconductor.org/packages/release/ bioc/html/edgeR.html Voom - algorithm (implemented in limma) Law et al., 2014 http://genomebiology.biomedcentral.com/ articles/10.1186/gb-2014-15-2-r29 https://bioconductor.org/packages/release/ bioc/html/limma.html
|
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
